(G-272) Polymeric Micelle Delivery of Cas9 Ribonucleoprotein for HEK293-GFP Gene Knockdown

Introduction:: Gene editing technologies hold tremendous potential to cure genetic diseases due to the ability to target specific DNA sequences and induce double-stranded breaks (DSBs) with high precision. This allows scientists to make specific changes and modifications to the DNA sequence. Clustered regularly interspaced short palindromic repeats-associated protein 9 (CRISPR-Cas9) is the most popular gene editing technology due to its ease of design and high efficiency and specificity. Viral vectors have been used for delivering CRISPR-Cas9 to targeted genes as a legitimate treatment for these genetic disorders, but their use is limited due to safety concerns. To overcome the limitations associated with viral methods of Cas9 delivery, we investigate the use of self-assembling polymer-based micelles as an effective encapsulation method and drug delivery system for the Cas9 ribonucleoprotein (RNP) to allow for non-viral gene editing. Specifically, by introducing a positive charge to the polymers, we aim to increase Cas9 RNP loading and facilitate intracellular entry and lysosomal escape, enabling gene editing in vivo.


Materials and Methods:: Polyethylene glycol and polylactic acid (PEG-PLA) micelles were synthesized through film rehydration. Micelles were characterized through dynamic light scattering (DLS) to determine size, polydispersity index (PDI), and zeta potential. Transmission electron microscopy (TEM) was used to confirm. Using maleimide bioconjugation chemistry, a positively charged peptide, transactivator of transcription of the human immunodeficiency virus (TAT), was added to enhance endocytosis and lysosomal escape. We designed two distinct guide RNAs (gRNAs) (CCATGGCACGGGCAGCTTGCCGG targeting GFP and TCCACCCCATTGACGTCAATGGG targeting the CMV promoter) and created Cas9 RNPs by combining 10 µL of gRNA with 10 µL of Cas9. Cas9 RNPs were tested for their ability to knockout green fluorescence protein (GFP) in HEK293-GFP cells via electroporation. Micelles were encapsulated with our top-performing Cas9 RNP and a micro bicinchoninic acid (µBCA) assay was used to calculate encapsulation efficiency. Following, we tested micelle-facilitated gene knockdown in HEK293-GFP. We incubated HEK293-GFP cells with 2,4,6, and 8 µg encapsulated Cas9 RNP per mL of media over a period of 5 days. We confirmed fluorescent knockdown and therefore Cas9 RNP delivery efficiency via fluorescence microscopy and flow cytometry.

Results, Conclusions, and Discussions:: Results/Discussions: Micelle synthesis was optimized using sonication and filtration to obtain the desired size and PDI to maximize cellular entry. Unloaded PEG-PLA micelles were found to have an average size of 62.21nm ± 0.56nm with an average PDI of 0.276 ± 0.008. The addition of TAT increased the average size and PDI to 136.03nm ± 9.24nm and 0.375 ± 0.100 respectively. We saw a change in surface charge from negative to positive with the addition of TAT. Using electroporation, we confirmed that the gRNA targeting GFP (CCATGGCACGGGCAGCTTGCCGG) in our Cas9 RNP led to the greatest knockdown at 56.3 ± 14.1% after 3 days (Figure 1). Therefore, we used this Cas9 RNP in further studies. PEG-PLA micelles encapsulated Cas9 RNP at an efficiency of 73.33% ± 3.06% with a maximum loaded content of 7.6 ug Cas9 RNP per 15 mg polymer. Treatment of HEK293-GFP showed slight fluorescent knockdown when compared to the control after 5-day incubation. Extended incubation times were required compared to electroporation to allow for the pH-driven degradation of the micelles, as PLA is a polyester.

Conclusions: PEG-PLA polymeric micelles can be formed at smaller diameters with the potential to bypass biological barriers and penetrate cellular membranes. TEM confirms the desired size and shape of the delivery system. TAT peptide was added to increase the surface charge. The µBCA assay proves micelles to be an effective encapsulation non-viral vector for Cas9 RNP. Fluorescent knockdown and flow cytometry data confirm the effectiveness of the drug delivery system. Further studies need to be conducted to confirm results and broaden testing. The next steps involve in vivo work to confirm fluorescent knockdown in the brains of genetically modified Zebrafish.


Acknowledgements (Optional): :

References (Optional): :