(I-353) Validation of PGBD5 as a DNA Transposable Element Required for Nervous System Development

Introduction::

DNA transposable elements are mobile DNA elements that have been identified in all organisms and compose around half of the human genome. Many of these elements have been domesticated and acquired vital functions in the organisms that host them.  We found that PiggyBac Transposable Element Derived 5 (PGBD5) is an evolutionarily conserved vertebrate DNA transposase-derived gene that is highly and almost exclusively expressed in neurons. Previously in our lab, we demonstrated that PGBD5 retains catalytic activity in human cells. Vertebrate brain development is associated with noticeable neuronal cell death and DNA lesions and requires neuronal cell diversification and self-organization into signaling networks. Since PGBD5 retains its catalytic activity and is highly expressed in neurons we hypothesized that PGBD5 may be required for normal nervous system development by regulating somatic DNA rearrangements in developing neurons. We identified two consanguineous families with PGBD5-predicted nonsense mutations  p.(Glu17*) in family 1 and p.(Phe170Serfs*5) in family 2. These mutations occur upstream of the evolutionarily conserved aspartate triad thought to be required for the biochemical activity of the PGBD5 DNA transposase domain in cells. Affected individuals presented with intellectual disabilities, movement disorders, and seizures, indicating that PGBD5 plays a major role in brain development. We validated that these predicted nonsense mutations were actually unable to produce PGBD5 protein through overexpression in HEK293T of the variants followed by western blotting.

Preferred Sub-Track: Epigenetics and Chromatin Regulation

Materials and Methods::

Family 1 Sanger sequencing was performed by Integragen on genomic DNA isolated from peripheral blood using forward primer 5’ GCTGGGAGGCACTGTGG and reverse primer 5’ CAGCCCACGGAGAGTCTG. Family 2 Sanger sequencing performed by Functional Bio on DNA isolated from peripheral blood using Forward primer 5’ TGGACAAGCTCTTACGTCCT and reverse primer 5’ CCCAGGGATTGGAAATGCAG. Samples from Family 2 were analyzed using whole-exome Illumina sequencing with a mean depth of coverage of 40x. A homozygous 1bp deletion resulting in a frameshift in PGBD5 was identified chr1:230492889 (hg19) NM_001258311.2 c.509 GA >G p.(Phe170SerfsTer5). An additional family was identified through GeneMatcher with a homozygous nonsense variant identified via ES as chr1:230425880C >A (hg38) NM_001258311.1 c.49G >T p.(Glu17*). All variants had gnomAD frequency=0. Variants were additionally verified by Sanger sequencing. 

We generated mammalian expression vectors through Atum bioscience and chemically synthesized PGBD5 wildtype, PGBD5 Glut17*, and PGBD5 Phe170Serfs*5 sequences adding a c-terminus Flag-tag for western blot detection and inserted them through restriction enzymes in a pD649 backbone—vectors, which were validated using long-read sequencing.

Vectors containing the variants of interest were transfected into HEK293T cells using Optimem medium and transit reagent following manufacturer instructions. We then extracted the proteins by cell lysis using radio-immunoprecipitation assay buffer with 1% SDS and supplemented with protease inhibitors. Proteins were validated through Western Blot analysis following protein quantification using flag and actin primary antibodies, and HRP conjugated secondary antibodies. Images were analyzed using chemiluminescent imaging. 

 

Results, Conclusions, and Discussions::

Recently our lab published the first evidence suggesting that PGBD5 is one of the key neuronal DNA nucleases required for brain function in mammals (Jubierre et al BiorXiv 2023), something which has long been speculated. Nonetheless, it was necessary to prove that the predicted nonsense mutations in PGBD5 from the affected families were not producing a functional protein. In order to validate that, we used mammalian expression vectors containing the coding sequence for PGBD5-Flag wildtype as a positive control, PGBD5-Flag Glu17* and PGBD5-Flag Phe170Serfs*5. We transiently expressed this PGBD5 form in HEK293T. First, we confirmed transfection efficiency above 60% of the plasmids using the GFP fluorescence conferred by the pD649 backbone. Then, we collected the cells and extracted protein to validate the expression of the different PGBD5 variants.  We observed that both PGBD5-Flag Glu17* and PGBD5-Flag Phe170Serfs*5 constructs were unable to produce PGBD5 as expected by their nonsense mutation, but our positive control PGBD5-Flag wildtype was able to express a full-length PGBD5. This indicates that the phenotype observed in humans is most likely induced by the lack of PGBD5 expression in their developing brains. This data together with our lab’s recent findings, demonstrates that PGBD5 expression and its catalytic activity offer a genetic mechanism for how somatic variation affects neuronal maturation and brain development.  

These findings have important implications for the evolution of other domesticated transposase-derived genes in vertebrates. While our findings suggest that PGBD5 expression is necessary for correct brain development in humans, additional studies are necessary to confirm the exact cellular, molecular, and enzymatic mechanisms of PGBD5 cellular activities and their developmental regulatory factors. Further work includes investigating the possibility that PGBD5 promotes somatic DNA rearrangements by recruiting other nucleases and chromatin remodeling factors. It is also possible that PGBD5 has additional nuclease-independent functions in nervous system development, such as those mediated by interactions with chromatin and other cellular factors. Finally, non-central nervous system contributions to the developmental defects observed in PGBD5-deficient mice and humans should not be ignored, as PGBD5 is likely expressed in the peripheral nervous system and possibly other tissues such as neuroendocrine systems.

Acknowledgements (Optional): : Thank you to the GSK SURP program for giving me the opportunity to be at MSK for the summer, as well as the Kentsis Lab, specifically Luz Jubierre and Makiko Yamada for mentoring me through this project.

References (Optional): : Jubierre et al BiorXiv 2023